rs12712065 chr2:100144643 C>G
- Sequence
cacaggaaaatcccaaggctccat[C/G]gctgggcaggcgagatgttggatt
- ASB for transcription factors
- CDK9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK9_HUMAN | -2.45 | 2.17 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, height, obesity with early age of onset (age >2), rheumatoid arthritis, type 1 diabetes, end stage renal disease, type 1 diabetes, end stage renal disease vs. normal albuminuria, years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Lung, Thyroid, Whole_Blood