rs12717 chr6:170553212 G>C
- Sequence
gttccatccccaagtctctgccag[G/C]agccgaatacatggctgtagagga
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) CTV-1 (Adult T acute lymphoblastic leukemia) primary B-CLL cells
- ASB for transcription factors
- TYY1_HUMAN KDM5B_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 0.54 | 3.23 | 1.42 | n/a | No Hit | |||
| KDM5B_HUMAN | 1.84 | -0.05 | 1.00 | n/a | n/a | |||
| BRD4_HUMAN | 1.01 | 0.41 | 1.45 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood