rs12780 chr4:80203442 G>C
- Sequence
tgcgatggagcccttggtgaagcg[G/C]cggcgagaggagaaactcaagtgc
- ASB in cell types
- G401 (rhabdoid tumor of the kidney)
- ASB for transcription factors
- SUZ12_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SUZ12_HUMAN | -0.00 | 2.73 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1