rs13117786 chr4:67481858 C>G
- Sequence
ttggcttaggcaaagacttcatga[C/G]caagaatccaaaagcaaacacaac
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | 2.54 | -1.75 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Hippocampus, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid