rs13119846 chr4:153494032 T>C
- Sequence
gtgtctgagaagctagaattgttg[T/C]gggtaaggacctgggctctgggtt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | 2.39 | -2.06 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hdl cholesterol, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), lung function, forced vital capacity (fvc) (fev1/fvc) percent predicted (in asthmatic participants), schizophrenia, sporadic creutzfeldt-jakob disease