rs13120709 chr4:168514628 C>T
- Sequence
tgacagaaatgaatgtttcagatt[C/T]tatttagattttttaacctatcaa
- ASB in cell types
- bipolar neuron IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -2.32 | 2.67 | 1.00 | |||
| IPSC-derived bipolar neuron | -1.54 | 2.12 | 1.00 |
Items per page:
1 – 2 of 2