rs13123131 chr4:27176634 C>T
- Sequence
agagtagagtctctagcatcacta[C/T]ctaaggctaacatctcagttcccc
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma) Peyer's patch hASC (preadipocytes) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2B (prostate carcinoma) | n/a | 2.75 | 2.00 | |||
| Peyer's patch | -0.16 | 2.50 | 1.00 | |||
| hASC (preadipocytes) | 2.31 | 1.78 | 1.00 | |||
| HeLa (cervical adenocarcinoma) | 1.50 | 0.46 | 2.00 |
Items per page:
1 – 4 of 4