rs13125101 chr4:80253438 G>A
- Sequence
agatatcctccagaatctccaagg[G/A]ggagaaagagggattctgttttga
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.50 | 0.18 | 2.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI cardiovascular disease, diastolic blood pressure, mean arterial pressure x alcohol consumption interaction (2df test), medication use (agents acting on the renin-angiotensin system), medication use (beta blocking agents), medication use (hmg coa reductase inhibitors), red blood cell count, systolic blood pressure