rs13126272 chr4:184810786 G>T
- Sequence
ttggggaaatgggcttagttatga[G/T]tttgttaggagccactgtgcttaa
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.62 | -0.74 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, irritible bowel syndrome, obesity with early age of onset (age >2), transmission distortion, type 1 diabetes, rheumatoid arthritis, crohns disease, combined case analysis, waist hip ratio