rs13128459 chr4:2469509 G>A
- Sequence
tcaccctggggggccgcggccatg[G/A]ggcttagttcctagcctaggaagg
- ASB in cell types
- primary B-CLL cells 22RV1 (prostate carcinoma)
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.38 | -0.49 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, comorbid depressive syndrome and alcohol dependence
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid