rs13128589 chr4:143609688 G>A
- Sequence
gcttcaaaaaccacataatgccat[G/A]tcatcatttttttgtctttcagag
- ASB in cell types
- A549 (lung carcinoma) HepG2 (hepatoblastoma)
- ASB for transcription factors
- MAFK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAFK_HUMAN | 2.12 | -1.75 | 1.50 | -2.03 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
