rs13129248 chr4:78059118 C>T
- Sequence
caaaccagagccgcggctgggcgg[C/T]ggcggcgggcgcagggcgggccgc
- ASB in cell types
- foreskin keratinocyte 22RV1 (prostate carcinoma) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- CTCF_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.03 | -0.18 | 1.25 | -0.40 | Weak Concordant | |||
| ANDR_HUMAN | 2.18 | -0.94 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
