rs13132143 chr4:65943260 G>A
- Sequence
ccctagtgtctggtatttgctagg[G/A]atacttggcattccttggcttctc
- ASB in cell types
- foreskin keratinocyte GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.41 | 2.20 | 2.33 | |||
| GM23338 | 2.38 | -2.48 | 1.17 |
Items per page:
1 – 2 of 2