rs13132590 chr4:66575229 G>T
- Sequence
atttcagctcctgatgggtccggg[G/T]ccaaggtccagcgccaagctgagt
- ASB in cell types
- MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.40 | 0.56 | 1.42 | n/a | No Hit |
Items per page:
1 – 1 of 1