rs13134240 chr4:102404955 G>C
- Sequence
atggaaacatctagaataatgttt[G/C]accaagtatctgagtacagtgacc
- ASB in cell types
- iPS-derived dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived dermal fibroblasts | -1.76 | 1.76 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Esophagus_Muscularis, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood