rs13137843 chr4:69318314 A>C
- Sequence
tgggagatgcagctattttttcaa[A/C]tatccaaattgcagccaacgagca
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) foreskin keratinocyte HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | n/a | 3.10 | 1.33 | |||
| foreskin keratinocyte | -0.38 | 1.47 | 3.00 | |||
| HUES64 (embryonic stem cells) | 1.91 | -1.57 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Colon_Transverse, Lung, Minor_Salivary_Gland, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid