rs13138404 chr4:87391352 C>T
- Sequence
cctagttctgctttgcgcagcccc[C/T]acgcggtgtgtggccgcgattgtc
- ASB in cell types
- HepG2 (hepatoblastoma) MS-1 (Small cell lung carcinoma) CD34+ hematopoietic stem cells spleen
- ASB for transcription factors
- CTCF_HUMAN TIF1B_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.51 | -0.06 | 1.38 | -3.10 | Concordant | |||
| TIF1B_HUMAN | -4.84 | 2.74 | 2.00 | n/a | n/a | |||
| FOXK2_HUMAN | 1.69 | -0.81 | 1.25 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, height, salmonella-induced pyroptosis, triglycerides, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood