rs13142370 chr4:26288339 C>T
- Sequence
ctgaagaatctgtttccaaggtgg[C/T]gctctcatggccgatggcagagtc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) monocyte-derived macrophages from peripheral blood MDM(monocyte derived macrophages) GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.76 | -0.98 | 1.00 | -2.63 | Concordant | |||
| SPI1_HUMAN | 1.29 | 0.37 | 1.61 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
