rs13144211 chr4:77240592 G>A
- Sequence
cgtgtcaggcagtacaggtgggcc[G/A]tggtgtgggttgggggagaatcag
- ASB in cell types
- gastroesophageal sphincter tibial artery glioblastoma patient-derived cell model
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| gastroesophageal sphincter | 0.90 | 2.99 | 1.00 | |||
| tibial artery | -2.41 | 2.65 | 1.00 | |||
| glioblastoma patient-derived cell model | 1.21 | n/a | 3.00 |
Items per page:
1 – 3 of 3