rs13146686 chr4:10033309 T>C
- Sequence
ctgcttcccaccttcctgtctcca[T/C]tggaggctcatctatctactccca
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 0.12 | 1.86 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), hdl cholesterol change with statins, maternal transmission distortion, microalbuminuria, prop taste detection threshold, refractive error, schizophrenia age at onset, serum urate, transmission distortion, uric acid
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Pancreas, Testis, Thyroid, Whole_Blood