rs13146825 chr4:26447549 G>T
- Sequence
gtcggcctacctgcctgcctgcct[G/T]cctgccttcctttctctcgctctc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.51 | -0.28 | 1.44 | 3.96 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
