rs13147760 chr4:108030583 C>G
- Sequence
aagcagatgttgggcaagtcccag[C/G]ccctcagctgtgctgatctggagt
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM18486 (Lymphoblastoid Cell Lines) HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.88 | 0.83 | 1.07 | n/a | n/a | |||
| CTCF_HUMAN | 0.59 | 0.85 | 1.28 | n/a | No Hit |
Items per page:
1 – 2 of 2