rs13148197 chr4:116668349 C>T
- Sequence
tgctggggacccttagatagttct[C/T]tgagggagatctaactgccttttc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 1.45 | -0.79 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.26 | -0.17 | 1.00 |
Items per page:
1 – 2 of 2