rs13148227 chr4:25993650 G>T
- Sequence
tgttatgtgagtgggcgggggtgt[G/T]tgacagcaccagtcacatccatcc
- ASB in cell types
- H929 (plasma cell myeloma) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 2.46 | -2.49 | 1.00 | |||
| MDM(monocyte derived macrophages) | 2.27 | n/a | 3.00 |
Items per page:
1 – 2 of 2