rs13148463 chr4:106502211 A>T
- Sequence
agggaatgcagcagtgcctttatt[A/T]atgagcagaggccaggataccgct
- ASB in cell types
- HeLa (cervical adenocarcinoma) MCF10CA1a (breast metastatic epithelial cells) A549 (lung carcinoma) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | 2.37 | -1.23 | 2.00 | |||
| MCF10CA1a (breast metastatic epithelial cells) | 2.89 | -2.77 | 1.00 | |||
| A549 (lung carcinoma) | 0.89 | 0.66 | 1.03 | |||
| H929 (plasma cell myeloma) | -1.69 | 2.09 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.09 | 0.84 | 2.00 |
Items per page:
1 – 5 of 5