rs13150460 chr4:102394781 C>T
- Sequence
aagtggtatatacgtcatcgggct[C/T]gagcaggtcctgaaggcacaagta
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- ATF2_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF2_HUMAN | 2.24 | -2.06 | 1.00 | n/a | No Hit | |||
| CREB1_HUMAN | 1.89 | -1.56 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood