rs13150997 chr4:174222342 C>T
- Sequence
ttgttgactgtttactacaattct[C/T]ggagcaccaatgactaaaacaaac
- ASB in cell types
- IPSC-derived bipolar neuron H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| IPSC-derived bipolar neuron | 1.82 | -0.70 | 1.00 | |||
| H929 (plasma cell myeloma) | -1.29 | 1.56 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Nerve_Tibial, Spleen, Stomach, Thyroid