rs13155659 chr5:55691757 T>C
- Sequence
aacctttctgtccctccactcaca[T/C]tccttattccacccccaaatcagg
- ASB in cell types
- foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.50 | 0.89 | 1.27 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, height, ldl cholesterol change with statins, mitral annular calcium, total cholesterol change with statins, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Brain_Amygdala, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg