rs13156926 chr5:106780575 G>T
- Sequence
gaagagaaggaaacaagtctgact[G/T]gcttctccacctactcattgtaga
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma) LNCaP (prostate carcinoma)
- ASB for transcription factors
- GRHL2_HUMAN FOXA1_HUMAN KDM5B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GRHL2_HUMAN | 1.42 | -0.81 | 1.50 | -1.02 | Weak Concordant | |||
| FOXA1_HUMAN | 0.96 | -0.03 | 1.65 | n/a | No Hit | |||
| KDM5B_HUMAN | 2.66 | -1.87 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, hdl cholesterol change with statins, kidney stones (nephrolithiasis), total cholesterol