rs13161260 chr5:110359067 T>C
- Sequence
tatttcttcatagcagcgtgagaa[T/C]ggagtaatacaatatgtatactat
- ASB in cell types
- MSC (mesenchymal stem cells)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 2.33 | -2.17 | 1.00 | -3.23 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Heart_Atrial_Appendage, Nerve_Tibial, Spleen, Testis