rs13163489 chr5:142324805 A>C
- Sequence
ggggagtcgcgtcgcggctcagag[A/C]ggggcagtttcagatctccaaacc
- ASB in cell types
- K562 (myelogenous leukemia) MS-1 (Small cell lung carcinoma) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- TIF1A_HUMAN VEZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TIF1A_HUMAN | n/a | 2.76 | 2.00 | n/a | n/a | |||
| VEZF1_HUMAN | -0.60 | 1.79 | 2.00 | 0.00 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
