rs13165263 chr5:84197709 T>A
- Sequence
aaaagttaagcatagctaaatttg[T/A]agaactgaaagaaatgcaatataa
- ASB in cell types
- monocytes from periferal blood macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocytes from periferal blood | -2.24 | 2.36 | 1.00 | |||
| macrophages form periferal blood | 0.94 | -3.28 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, major depressive disorder and bipolar disorder combined analysis, obesity with early age of onset (age >2)