rs13166368 chr5:168941989 C>A
- Sequence
gagaggctgtcacctttcctccag[C/A]caccacatctgcatctttttcagt
- ASB in cell types
- BE2C
- ASB for transcription factors
- HAND2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HAND2_HUMAN | -4.07 | 2.30 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, comorbid depressive syndrome and alcohol dependence, eye color, years of education