rs13168171 chr5:76472914 A>G
- Sequence
ctttactcacaaggattatcacac[A/G]agtgtctactcaccaggcacggtg
- ASB in cell types
- HepG2 (hepatoblastoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.19 | 0.45 | 1.14 | |||
| A549 (lung carcinoma) | 0.90 | 0.08 | 2.03 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, infant head circumference, ldl cholesterol, ldl cholesterol change with statins, mitral annular calcium, total cholesterol