rs13169113 chr5:126002782 A>C
- Sequence
aatttgagagccttagacctctgg[A/C]aaggggagggagagagagaaaaaa
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 1.72 | 0.49 | 1.75 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, cystatin c in serum, delayed story recall, eye color, immediate story recall, microalbuminuria, resistance to kuru in aged women despite likely exposure, serum creatinine, sporadic creutzfeldt-jakob disease, triglycerides change with statins