rs13170017 chr5:151087229 A>C
- Sequence
gaggggaattccccgagatggagg[A/C]gccgccaccaggcagccccgcaag
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -2.88 | 3.29 | 1.00 | 1.28 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
