rs13170300 chr5:150449748 G>A
- Sequence
cacaccggaaagagagagtgggag[G/A]gggcggagcgacgggggtcacttc
- ASB in cell types
- T47D (invasive ductal carcinoma) HepG2 (hepatoblastoma) CD14+ monocytes GM18951 (B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAT1_HUMAN SMAD2_HUMAN EGR1_HUMAN GABPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.34 | -4.53 | 2.00 | n/a | No Hit | |||
| SMAD2_HUMAN | 0.79 | 2.39 | 1.80 | n/a | No Hit | |||
| EGR1_HUMAN | 1.61 | -0.40 | 1.08 | -2.49 | Concordant | |||
| GABPA_HUMAN | 0.17 | 1.38 | 1.50 | n/a | No Hit | |||
| KDM5A_HUMAN | -0.28 | 2.24 | 1.67 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid