rs13173077 chr5:58182071 G>A
- Sequence
taaaatgctgaaaccattatccaa[G/A]gaagtacaaatttccgtgctaaag
- ASB in cell types
- LNCaP (prostate carcinoma) T47D (invasive ductal carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN A2NVP9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.56 | 0.08 | 1.86 | n/a | No Hit | |||
| A2NVP9_HUMAN | 2.65 | -1.19 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, prop taste detection threshold, rheumatoid arthritis, stabilized warfarin dose, total cholesterol, urinary albumin-to-creatinine ratio, years of education