rs13178975 chr5:71758008 G>A
- Sequence
ggggtcatgggtctttaacctcac[G/A]atgaacctgccgtggaagaaagag
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 1.35 | -0.10 | 1.10 | -0.41 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP abnormal involuntary movement scale, college completion, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol change with statins, parkinsons disease, refractive error, total cholesterol, total cholesterol change with statins