rs13179828 chr5:155129343 C>G
- Sequence
gtaacttacccaaggtcacacaac[C/G]agctaatggcagcgccagtgccaa
- ASB in cell types
- 22RV1 (prostate carcinoma) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.88 | -0.86 | 2.00 | |||
| breast tumor | 1.97 | 0.08 | 2.00 |
Items per page:
1 – 2 of 2