rs13183304 chr5:17951979 T>C
- Sequence
ccccactgagaaagcaagcaagcc[T/C]ttccggttttgcacttccctgcct
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma) LNCaP (prostate carcinoma) ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Ishikawa (endometrial adenocarcinoma) | 2.33 | -0.46 | 1.50 | |||
| LNCaP (prostate carcinoma) | 0.93 | -0.23 | 1.48 | |||
| ZR-75-1 (invasive ductal carcinoma) | 1.34 | -0.09 | 2.00 |
Items per page:
1 – 3 of 3