rs13183341 chr5:76431906 G>A
- Sequence
tctcctcagtggcagcagttcctg[G/A]aatgtgtggtgattccaaatgatc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) monocyte-derived dendritic cells MDM(monocyte derived macrophages) macrophages form periferal blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.85 | 2.90 | 1.44 | 2.16 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
