rs13183870 chr5:141924068 C>A
- Sequence
gaaacagccgaagcgatcgtgggc[C/A]gggttagagccaaggaaggcgggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HepG2 (hepatoblastoma) MDM(monocyte derived macrophages) monocytes from periferal blood
- ASB for transcription factors
- SPI1_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.10 | 0.67 | 2.38 | n/a | No Hit | |||
| FOXK2_HUMAN | 1.99 | 0.34 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2