rs13185307 chr5:125227611 A>G
- Sequence
gcatggctgaaagaccaccaccat[A/G]taaacaataacaaggcctgttggc
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -1.22 | 1.79 | 1.00 | |||
| HEK293 (embryonic kidney) | -0.42 | 1.25 | 1.50 |
Items per page:
1 – 2 of 2