rs13186279 chr5:53871250 C>T
- Sequence
cttctgccctctgctgcccacaaa[C/T]aattaaaaagtgatggtcagaatt
- ASB in cell types
- NOMO-1 (acute monocytic leukemia) liver HCAEC (human coronary artery endothelial cells) HepG2 (hepatoblastoma)
- ASB for transcription factors
- ZF64B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZF64B_HUMAN | 1.76 | -0.36 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1