rs13188076 chr5:148720430 G>T
- Sequence
actctgtttccctgcatttctctt[G/T]gtgctattctcatctgtttgctct
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | -0.29 | 1.43 | 2.04 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hdl cholesterol change with statins, ldl cholesterol change with statins, microalbuminuria, refractive error, total cholesterol change with statins