rs13189930 chr5:14727773 C>A
- Sequence
tatagggtttcagttttgcaatcc[C/A]gttatgggcagatggtgatgacaa
- ASB in cell types
- THP-1 (acute monocytic leukemia) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 1.77 | -1.46 | 1.50 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.54 | 0.94 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, infant head circumference, mitral annular calcium, rheumatoid arthritis, sporadic creutzfeldt-jakob disease, variant creutzfeldt-jakob disease, waist hip ratio
GTEx eQTL Artery_Tibial, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood