rs13192185 chr6:37742391 G>A
- Sequence
aggaggacaaggtaaacacaacct[G/A]ggaaaggtgaaggaggcaatttgg
- ASB in cell types
- epithelial cell of prostate iPS-derived dermal fibroblasts
- ASB for transcription factors
- CTCF_HUMAN RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.57 | 0.21 | 1.44 | n/a | No Hit | |||
| RARA_HUMAN | 1.87 | 1.07 | 1.00 | -0.75 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
