rs13192469 chr6:31559079 T>C
- Sequence
gggtcttgtccaccctgcaatctg[T/C]ggctggagaaatagatgcgaacag
- ASB in cell types
- CD14+ monocytes naive IgD+ B cells HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.32 | -0.76 | 2.00 | n/a | No Hit | |||
| STAT1_HUMAN | 1.37 | -0.35 | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol, microalbuminuria, prop taste detection threshold, rheumatoid arthritis, total cholesterol