rs13195786 chr6:10163735 A>G
- Sequence
gtccacaaacctggcaaagggcct[A/G]tgattttatgccttgaggtaagaa
- ASB in cell types
- breast tumor 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ESR1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 3.08 | -5.59 | 2.00 | n/a | No Hit | |||
| ANDR_HUMAN | 2.74 | -5.07 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, aortic valve calcium, autism, fasting insulin, homa-ir, rheumatoid arthritis, serum calcium
PheWAS absent or infrequent menstruation, acne, anomalies of pupillary function, asthma, asthma with exacerbation, atrial flutter, benign neoplasm of colon, benign neoplasm of uterus, cancer of other male genital organs, cancer of the digestive organs and peritoneum, cardiac arrhythmia nos, cholecystitis without cholelithiasis, chronic kidney disease, stage i or ii, circumscribed scleroderma, colon cancer, colorectal cancer, complication of amputation stump, congenital anomalies of limbs, cornea replaced by transplant, corneal dystrophy, derangement of joint, non-traumatic, diseases of the jaws, diseases of the tongue, disturbance of skin sensation, dysmetabolic syndrome x, dysuria, elevated sedimentation rate, frequency of urination and polyuria, gastritis and duodenitis, nos, glossodynia, hallux valgus (bunion), heart valve replaced, heartburn, hereditary hemolytic anemias, hyperosmolality and/or hypernatremia, hypotension nos, impetigo, infections of kidney, iron deficiency anemias nos, lack of coordination, loose body in joint, lymphadenitis, meningitis, migraine, multiple myeloma, musculoskeletal symptoms referable to limbs, nasal polyps, oliguria and anuria, other abnormality of urination, other congenital anomalies of skin, other derangement of joint, other disorders of tympanic membrane, other hemoglobinopathies, other specified diseases of sebaceous glands, personal history of allergy to medicinal agents, poisoning by agents primarily affecting blood constituents, pseudomonal pneumonia, retinal edema and hypertensive retinopathy, sarcoidosis, scoliosis, secondary malignancy of bone, secondary malignant neoplasm, secondary malignant neoplasm of liver, sinoatrial node dysfunction, skin neoplasm of uncertain behavior, subjective visual disturbances, symptoms/disorders of the urinary system, systemic sclerosis, unspecified monoarthritis, urinary incontinence, uterine/uterovaginal prolapse, viral enteritis